CHRNIC LYMPHLEUCOSIS

Sarkom

SKAP ET NYTT MELDING.

Men du er en uautorisert bruker.

Hvis du registrerte deg tidligere, så logg inn (påloggingsskjema øverst til høyre på siden). Hvis dette er første gang her, kan du registrere deg.

Hvis du registrerer deg, vil du kunne spore svar på meldingene dine i fremtiden, fortsette dialogen i interessante emner med andre brukere og konsulenter. I tillegg vil registrering tillate deg å føre privat korrespondanse med konsulenter og andre brukere av nettstedet.

Oncology

En foreløpig diagnose er kronisk lymfocytisk leukemi, basert på en blodprøve. Sendt til hematolog (har ennå ikke gått, høytider og alt det der).

Hemoglobin 145,
Hvite blodlegemer 23.6,
Metamyelocytter 4,
Stab 5,
Segmentert 17,
Lymfocytter 79.

Generelt vil jeg vite hva slags sykdom er dette - kronisk lymfocytisk leukemi? Og viktigst av alt, hva er spådommene for å behandle ham i Israel??

God ettermiddag! Kronisk lymfocytisk leukemi har en bred differensialdiagnose og krever ytterligere studier, for eksempel benmargsbiopsi og avanserte blodprøver. Hvis denne diagnosen faktisk er bekreftet, er prognosen ganske god. Med riktig behandling lever pasienter i flere tiår og har det bra.

Hei hei. ".. en bred differensialdiagnose.." - slik forstås i oversettelse til ordinært språk?

det vil si at hvis diagnosen er bekreftet, behandles den lett? Hvilke tester trengs for å bestemme diagnosen nøyaktig? Kanskje det gir mening for oss å komme til deg med resultatene? Og i gjennomsnitt, til pris og tid for diagnose og behandling, hvor mye penger trenger du? Det vil for eksempel være mulig å gjennomgå diagnostikk, og gjøre injeksjoner hjemme?

En bred differensialdiagnose betyr at det er mange sykdommer der det kan være slike blodprøver, og det primære målet er å stille en diagnose.
Jeg anbefaler ikke å gjøre tester i Russland, fordi det viktigste for resultatet av behandlingen er korrekt diagnostisert.
Det er ingenting i mellom. Legen skal motta alle dokumentene og snakke med pasienten på telefon. Etter det sender vi en undersøkelsesplan og forklarer, når det er mulig, hvor mye behandling som kan koste..

Kronisk lymfocytisk leukemi er vanligvis "langsom" leukemi, og dette er flott - fordi du kan ta en "pause" og tenke i en uke. Dra nytte av dette! Det er vanskelig å høre en alvorlig diagnose. Ofte, på grunn av en "panikk", tar folk beslutninger som de ikke synes å være riktig til..

Jeg vil tilby deg en fraværskonsultasjon med professor Shapiro (spesialisert i hematologi), som på bakgrunn av analysene og utdragene du har for hånden, vil utarbeide en foreløpig eksamensplan. I tillegg til vanlig blodprøve, FISH, en benmargsbiopsi, vil det sannsynligvis være behov for en MR-undersøkelse (for å bestemme de berørte lymfeknuter). Videre vil det være mulig å stemme den eksakte prisen (i henhold til prislisten til Hadassah sykehus).

Hvis diagnosen blir bekreftet, vil professor Shapiro foreskrive behandling. Kostnadene for behandling kan variere veldig, avhengig av anbefalingene fra professor Shapiro, hans behandlingsplan. Professor Shapiro En unik spesialist - han har veldig høye kurerhastigheter.

Hallo, fortell meg Coca-varselet når du analyserer BCR -ALB p210 (b3a2) - t (9; 22) 167%
Takk på forhånd!

Gjennomgang av behandlingen

Hematolog, hemostasiolog, sexolog, familielege, professor ved Center for Postgraduate Medical Education, Institute of Medicine and Psychology, Novosibirsk National Research State University, spesialist i klinisk og laboratoriediagnostikk av blodkoagulasjonspatologi, medlem av National Association of Thrombosis and Hemostasis (ISTH), American Association of Hematologists (AHA), National Association of Thrombosis, Clinical Hemostasiology and Hemorheology Specialists, MD, professor, RAE.

Arbeidserfaring - 16 år.

Rådgiver om:

  • Diagnostisering og behandling av blodkoagulasjonsforstyrrelser hos barn og voksne (0+).
  • Behandling av gravide med hemostatisk patologi (arvelig og ervervet trombofili).
  • Felles løsning med gynekologer av problemer med spontanabort og infertilitet.
  • Valg av et individuelt profylaktisk terapiprogram for pasienter som tar hormonelle legemidler (GOK, COC eller HRT) i nærvær av en trombofil bakgrunn.
  • Forberedelse til graviditet for pasienter med hemostatiske lidelser.
  • Diagnostisering og behandling av antifosfolipidsyndrom.
  • Diagnostikk og behandling av blødningssyndrom.
  • Utvikling av et behandlingsprogram som forberedelse til IVF hos pasienter med patologi av blodkoagulasjonssystemet (sammen med gynekologer-reproduktologer).
  • Identifisering og observasjon av pasienter med genetisk (arvelig) trombofili.
  • Diagnostisering og behandling av anemi.
  • Konsultasjoner om klinisk sexologi og sexopatologi.

Gjennomgang av behandlingen

Jeg lager likevel mitt eget tema.
For ikke så lenge siden, på jakt etter et "mirakel", dro jeg til dette forumet, og jeg var interessert i emnet om CML, fordi Jeg har en lignende diagnose med navn - CLL.
Fra det emnet lærte jeg om en alternativ behandling - MMS. Jeg har ikke prøvd eller møtt noe slikt ennå..
Overførte noen meldinger fra emnet CML, slik at betydningen ikke går tapt.
Jeg vil være takknemlig for alle som kan gi råd til noe for behandling.

Fra den forrige erfaringen (før cellegift) prøvde jeg mye - bioenergeterapi, aconitt, Todicamp, ASD, cardyceps og til og med forskjellige metoder, gikk til og med til Ayat-sekten. :-)
Positiv dynamikk ble gitt av ASD, cardyceps, aconite. Men leukocytter fortsatte å vokse og i 2009 gjorde 6 kurs cellegift, hvoretter det var remisjon. Sykdommen er uhelbredelig for øyeblikket, hvite blodlegemer gikk opp i februar 2013, jeg vil i det minste ønske å begrense veksten.

Analyse bestått 06/17. Hvite blodlegemer 54.4, lymfocytter 74. Jeg begynner å drikke fra i morgen MMS.
Begynte å drikke siden torsdag. Den første dråpen gikk bra, den andre også. Fortynnet med vann, syltet ikke. Det var normalt å drikke, ikke engang drikke og ikke syltetøy. Jeg bestilte her - http://mms-club.ru/index.php/2014-01-18-19-01-35. MMS og HCL (aktivator). En slags ny aktivator (de sier det), det er lettere å drikke med det og det er ikke nødvendig å lage CDS.
Diaré startet på tredje slipp, men bestemte seg for å legge til mer likevel, fordi syndet for mat. 4 dråper kom med vanskeligheter. Om kvelden forverret diaré seg, hele natten var det denne ekle smaken i munnen min og kvalmen kom opp i halsen på meg.
Om morgenen reduserte jeg dosen til to dråper..
Kan du virkelig bli vant til det? Du kan ikke si at det er helt stygt, men.
Og det er nødvendig å øke i henhold til 2000-protokollen til 12 dråper.
Jeg drakk kapsler med grønn teekstrakt før, kansellert, fordi det er en antioksidant. Venstre ben av en bitter aprikos.

Etter denne meldingen svarte MikEBB til meg at det ikke skulle være diaré eller kvalme. Ellers vil jeg ikke kunne fortsette behandlingen. Bare det å tenke på MMS vil være dårlig. Det er bedre å komme ned til en lavere dose og gradvis øke, enn å vende bort slik at behandlingen ikke blir mulig å fortsette. Hvis MMS er hovedbehandlingen, er det bedre å fjerne aprikoskjerner. Faktum er at beinene inneholder gift, og MMS er designet for å nøytralisere giftstoffer i kroppen. Det viser seg at vi på den ene siden nøytraliserer beinene til MMSK, og på den andre siden bruker vi MMS på beinene. Et unntak kan bare være en medisin som du ikke kan gjøre uten. Og du kan også lage komprimeringer med MMS og dimexid, så trenger MMS seg inn i lymfen.

24.06 - Jeg fjernet også beinene (for eksperimentets renhet).
Jeg drakk 3 dråper i går. Om kvelden hjemsøkte jeg bare denne lukten. Men diaré stoppet. I dag drakk jeg 4 om morgenen og satt i 10 minutter, alt ba om å gå tilbake.. Jeg leste Humble sine anbefalinger i går, jeg trenger å prøve litt juice istedenfor vann.
Ja, en bivirkning dukket opp - hun mistet 1,5 kg (jeg spiser som vanlig!). Jeg drømmer om å miste 3 kg i et år, men her er det umerkelig.

Begynner å drikke i morgen mms.

Takk breganika Et veldig verdifullt eksperiment! Jeg mottar postlisten til MMS-forfatteren. De skriver om mirakler! En kur mot hepatitt som ikke kan kureres av noe! Og så videre. De arrangerer pågående workshops og trening rundt om i verden. MMS har fascinert meg lenge, jeg prøvde å drikke det selv, men jeg kunne ikke på grunn av smak, lukt. Derfor likte jeg ideen om MikEB å drikke i en annen form. Men jeg kunne ikke få tak i alt. Jeg tror denne formen er mer akseptabel..
Suksess for deg! Jeg holder nevene! Rapporter regionalt som hva.
Prøv å ikke gi etter!
Alt vil lykkes!

Kjære, slik jeg forstår deg, oppstår kronisk lymfocytisk leukemi, det vil si ondartede prosesser i modne lymfocytter, sammenlignet med akutt leukemi, der blod oversvømmes med umodne eksplosjonsceller og er preget av prosessens hastighet, sykdommen din er mer godartet med muligheten for langvarig remisjon.
Mens jeg studerte leukemi for mange år siden, leste jeg om benmargstransplantasjoner, så vel som andre transplantasjoner, som i noen tilfeller ga 100% kur.
Det vanlige navnet på denne metoden kalles transplantasjonsfenomenet mot leukemi..
Jeg vil skrive til deg i en personlig e-postadresse til en person som kan gi deg noen
tips for homeopatisk behandling av leukemi (gratis).

Lite spørsmål, hva er din blodtype og rhesus.

Kan du gjøre klyster, de lindrer kvalmen godt.

Og du kan lese mer, hva slags klyster?

Herpes hopper av annenhver dag på forskjellige steder der han ikke hadde dukket opp før, bare på leppa, i ansiktet.

Herpes reaksjon av forverring av sår med en sterk alkalisering av MMS.. Jeg hadde noe lignende. Jeg tror dette er en normal prosess..
Nå minst til lørdag!

Alle gutta! Jeg er på randen.
Syk av en slags boble. Antallet dråper reduserte igjen, diaré begynte. Kort sagt, mindre enn hyggelig enn ubehagelig. Fikk ut hemoroider. Herpes hopper av annenhver dag på forskjellige steder der han ikke hadde dukket opp før, bare på leppa, i ansiktet.
Antallet mottakelser er også redusert, jeg aksepterer hvordan mer eller mindre kvalme passerer.
Inntil lørdag kunne jeg holde ut, bestå analysen.

Noen mennesker kan ikke ta medisiner i henhold til standardordninger, men jeg forstår at du prøver å drive deg inn i standardene, jeg mener antall dråper, administrasjonsfrekvens osv. Jeg har erfaring med MMS og CDS og har til og med nådd doser som overstiger anbefalingene, men jeg gjorde alt dette P-O-S-T-E-P-E-N-N-O. Jeg vet førstehånds hvor ubehagelig MMS er etter en overdose, og hvordan bare det å tenke på det får meg til å krype, og jeg advarte deg om dette i innleggene mine. Nå har du din egen erfaring :-). Hva ville jeg gjort i din situasjon videre? Hvis du har tid, kan du sette av å motta MMS i et par uker, men lov deg selv at du kommer tilbake til det. Drikk et kurs med vitamin C på dette tidspunktet, rikelig med fersk fersk juice og levende mat, slapp av. Finn deretter din MMS og ta deg god tid, start med en halv dråpe på et halvt glass eplekompott uten sukker, begynn å ta 1 - 2 ganger om dagen, men bare slik at du er komfortabel. Hold deg en halv dråpe i flere dager, og når du er overbevist om at denne teknikken ikke gir deg noe ubehag, kan du gå opp til dråpen. Hvis du etter 2 til 3 dager er sikker på at alt er i orden og en dråpe ikke forårsaker problemer --- beveger deg også sakte lenger. Hvis du i det minste litt føler deg ubehagelig, ta et skritt og eller til og med to bakover, styrker din posisjon og fortsetter videre til den terapeutiske dosen.
Jeg ønsker deg forsvarlighet og seier over sykdommen.

Noen mennesker kan ikke ta medisiner i henhold til standardordninger, men jeg forstår at du prøver å drive deg inn i standardene, jeg mener antall dråper, administrasjonsfrekvens osv. Jeg har erfaring med MMS og CDS og har til og med nådd doser som overstiger anbefalingene, men jeg gjorde alt dette P-O-S-T-E-P-E-N-N-O. Jeg vet førstehånds hvor ubehagelig MMS er etter en overdose, og hvordan bare det å tenke på det får meg til å krype, og jeg advarte deg om dette i innleggene mine. Nå har du din egen erfaring :-). Hva ville jeg gjort i din situasjon videre? Hvis du har tid, kan du sette av å motta MMS i et par uker, men lov deg selv at du kommer tilbake til det. Drikk et kurs med vitamin C på dette tidspunktet, rikelig med fersk fersk juice og levende mat, slapp av. Finn deretter din MMS og ta deg god tid, start med en halv dråpe på et halvt glass eplekompott uten sukker, begynn å ta 1 - 2 ganger om dagen, men bare slik at du er komfortabel. Hold deg en halv dråpe i flere dager, og når du er overbevist om at denne teknikken ikke gir deg noe ubehag, kan du gå opp til dråpen. Hvis du etter 2 til 3 dager er sikker på at alt er i orden og en dråpe ikke forårsaker problemer --- beveger deg også sakte lenger. Hvis du i det minste litt føler deg ubehagelig, ta et skritt og eller til og med to bakover, styrker din posisjon og fortsetter videre til den terapeutiske dosen.
Jeg ønsker deg forsvarlighet og seier over sykdommen.


Åh, tusen takk! Jeg er så takknemlig for deg!
Ja, fordi jeg leste deg, men det ser ut til at jeg måtte utvikle min erfaring.
Tross alt bestemte jeg meg for å gjøre det - det ble ille, jeg reduserer dosen og antall doser. Jeg reduserte dem til tre om dagen, men noen ganger gjør jeg to. Hvis du rister før en dose, så hopp over. Jeg skal analysere i morgen.

breganika,
Av hele mitt hjerte ønsker jeg deg gode tester og alt godt.

Resultatet er hvite blodlegemer 40 (15,4 mindre enn forrige analyse), 72 lymfocytter (det var 74).
En liten sammenligning er ikke riktig, fordi forrige gang det ikke var noen laboratorieassistent, gjorde maskinen.
Kategorisk MMS, så langt, avviser jeg ikke. Vi må se videre i dynamikken. Lab-assistenten min sluttet, men dette viste tilsynelatende ikke dårlig til og med gjennom mikroskopet mine lymfocytter. : D

Ingen referanseverdier. Gode ​​tester eller dårlige, hvordan vurderer du? Det var bedre før eller etter?

Jeg har en jevn økning i hvite blodlegemer og lymfocytter. Den siste analysen var 06/17. Sammenlignet med ham, reduserte hvite blodlegemer med 14,4 enheter. I min sykdom spiller hver tiende en rolle, så hvis den forrige ble gjort bra, så er det en forbedring.

Så det ville være verdt å fortsette, bare for å forbedre metoden, slik MikEB råder..

Så jeg skriver at vi må se nærmere. Hvis det er en nedgang på et par uker, fungerer det definitivt.

Modig deg. Du trener immuniteten din))). Jeg fant noen nyttige nettsteder med alternative behandlinger. Det er et sted med en fullstendig bekreftet kur, det er flere med en betydelig reduksjon i hvite blodlegemer. Hvis det er mulig, vil jeg gi deg lenker.
Om meg selv. 55 år. CLL fra oktober 2013. I følge gamle tester (jeg savnet lege siden 2011 (kanskje fra 2009, hvis vi anser lymfocytter 4.9 som signifikante).

Arin, jeg vil bare være takknemlig for deg!
Jeg har aldri møtt før at noen ble kurert, det ser ut til at jeg går til feil nettsteder. - (
Eksperimenter med egen risiko og risiko, du har rett.
Og du prøver selv noe fra alternativ, eller fra folkemunne?
Forresten, vi er på samme alder!

Jeg vet ikke om det er mulig å gi lenker til andre ressurser (utenlandske fora). Hvis mulig, vil jeg gi en lenke der personen ble kurert av CLL. Riktig nok var han 28 år gammel. Og jeg kan gi en kobling til en australier som senket hvite blodlegemer fra 77 til 3.
Jeg har store planer - jeg gravde frem mye informasjon fra utlendinger. Fortsatt har de slike pasienter-160 000. Og i Russland, rundt 15 000. Jeg vet ikke hvordan du har det i Kasakhstan. Selv om jeg, hvis jeg har identifisert deg riktig, husker jeg at du er en russisk kvinne

Etter min mening kan du gi lenker. Jeg så at de gir. Vi leter alle etter behandlinger her..
I verste fall kan du i PM definitivt skrive.
Jeg, på en eller annen måte, ble vant til det, jeg anser det ikke en gang for å være en behandling, forgjeves, sannsynligvis.
Jeg bruker den bare lenge. Jeg spiser pollen (kjøp og bland med honning). Jeg drikker bare grønn te, noen ganger drikker jeg sikori istedenfor kaffe. I tillegg teekstrakt i kapsler (jeg husker ikke doseringen, en krukke hjemme). Så en kapsel, nå to.
Ja, utlendinger har mer med CLL. Jeg er en russisk kvinne, du tar ikke feil.
Jeg har bodd i Kasakhstan i 9 år. Kazakere får veldig sjelden CLL og CML. De har ofte lavt hemoglobin eller akutt leukemi. Det er alt jeg tror - kanskje de spiser slik at de ikke blir syke av vår?
Noen ganger husker jeg om såre mine, det vil selvfølgelig føles litt trist, men du trenger å leve!
Etter kjemi gikk jeg på danser og det styrker så mye! Stemningen øker!
Og i august lager datteren en gave - barnebarnet blir født! Den første!
Livet går videre!

Så gir jeg lenker til alt nyttig som jeg gravde opp

Her litt uklart, mange lenker til hvor han kjøper. Resultatet er kortvarig. Men verdt å lese

Her, etter min mening, det mest interessante

Nå har jeg bestått analysen for metaller og andre giftstoffer (etter hår). Jeg vil få svar, jeg vil skrive til ham

Det er bare nysgjerrig her. Men slik jeg forstår det, er det ingen spesielle resultater.

Denne bloggen handler om nye medisiner. Det handler om offisiell medisin, men det beroliger meg litt. Skriver en lege, en født kanadier fra USA. Flyttet TKM (Han er Ashkenazi jødisk etter nasjonalitet)

Her er CLL Support Forum
http://translate.google.com/translate?hl=en&sl=en&u=http://www.dailystrength.org/c/Chronic-Lymphocytic-Leukemia-CLL/forum&prev=/search%3Fq%3Dforum%2Bcll%26newwindow % 3D1% 26sa% 3DX% 26hl% 3Dru% 26biw% 3D1275% 26bih% 3D582
Mange nyttige alternativer, for eksempel kalsium og D3. Men jeg går ikke til nettstedene de anbefaler, jeg vil ikke ha noe negativt
http://translate.google.com/translate?hl=en&sl=en&u=http://www.dailystrength.org/c/Chronic-Lymphocytic-Leukemia-CLL/forum&prev=/search%3Fq%3Dforum%2Bcll%26newwindow % 3D1% 26sa% 3DX% 26hl% 3Dru% 26biw% 3D1275% 26bih% 3D582

Karl Junks forskning bringer meg også til det normale. Det er CI. Og også en ideell remisjon)) Men i vår sykdom så langt bare 50%. Men de jobber.
Gratulerer så mye med barnebarn din. Jentene mine føder ikke enda)))

+brusinntak (Dr. Youngs metode, økende ph, jeg har endometrialt adenokarsinom).

Hva er ph? Hvordan måle?

Så gir jeg lenker til alt nyttig som jeg gravde opp


Veldig interessant å lese!
For øvrig kom jeg på en eller annen måte over en artikkel der en pasient med CLL ble kurert av kostholdet (Hallelujah). Spesielt da så jeg etter hva slags kosthold.
Men. Interessant. En australier som har redusert hvite blodlegemer, fulgte ikke et vegetarisk kosthold.
Først klatret jeg selvfølgelig til helbredende steder.

Så vidt jeg forstår skal ikke leukemi følge et vegetarisk kosthold. Det virker som om 70-80% grønnsaker og lignende og noe kjøtt og protein er nødvendig.
Jeg prøver å drikke ekstrakt av grønn te nå (jeg skrev om det). Men da jeg begynte å drikke te fra januar, økte AST og ALT - to ganger normen. Så kom de tilbake til det normale. Du må velge hva som er viktigere i dette tilfellet, leukocytter eller leverindikatorer. Så tar jeg et kurs med quercetin- (bokhvete i kapsler))). Jeg begynner 20. juli. Etter resultatene av analysen for giftstoffer, vil jeg prøve å be om den komplette listen over tester som australieren tok. Og prøv å se etter en urtemedisin. Jeg sjekker leukocyttformelen hver 7.-10. Alt henger med

Ja, jeg leste at vi definitivt trenger protein. Vi anbefaler hestekjøtt her, det regnes som det reneste kjøttet. Da jeg gikk på et bokhvete-kosthold, fortalte de meg også - hvorfor ikke prøve quercetin kapsler. Konsentrasjonen er større. Jeg vil gjenta bokhvete-dietten, men etter slutten av fruktsesongen.
Velg en urtemedisin som står. Jeg gikk til en. Helt ærlig, havre drakk deretter om en måned - 10 hester ville være nok. :-)
Da jeg kom begynte jeg med det. men Raisa Gorbacheva døde, og du går fremdeles. Så motbydelig. Dessuten hadde hun et helt annet.
Jeg ønsket å spørre - hvor gjorde analysen av hår, jeg leste i lenkene om det, men hvordan vi kaller det og hvor jeg skulle gjøre det.

Bokhvete diett er for restriktivt for grønnsaker og frukt..
Analysen ble gjort i INVITRO. Har du en i Kasakhstan? Hvis det er det, vil jeg si tallet. Men jeg vet ikke resultatene ennå, så jeg kan ikke anbefale det. Men jeg har en segl-8 og alt-amalgam. Og 3 broer til.


Ja, viser det seg INVITRO.
Tetning og broer er også nok! Ja, og under kronene, disse fyllingene.

Med surhet klarer jeg heller ikke å nå 7 om kvelden, og ikke mer enn 6 om morgenen. Jeg leser tips om brus.

Jeg finner ikke lakmuspapir noe sted (kanskje jeg ser dårlig ut).
Jeg har lest koblingene dine, men ikke alle. takk igjen!
Jeg kom til den konklusjonen at vi må øke mengden grønn te. Tilsett vitamin D (jeg drakk ikke det i det hele tatt) og vitamin C.
Nå er jeg ferdig med eksperimentet med MMS, fordi C-vitamin anbefales ikke der, og spredning i tid er upraktisk.

Jeg søkte etter informasjon i dag via MMS, kom over en nettside - www.salinomycin.ru


Nettstedet er rart, det åpnes ikke til slutt.. Har du prøvd å gå dypt ?? åpen?
Det pågår en diskusjon om stoffet Salinomycin, som dette selskapet bruker. fra et annet forum.
http://rak.flyboard.ru/topic988.html

Nettstedet er rart, det åpnes ikke til slutt.. Har du prøvd å gå dypt ?? åpen?
Det pågår en diskusjon om stoffet Salinomycin, som dette selskapet bruker. fra et annet forum.
http://rak.flyboard.ru/topic988.html

Det ser ut til å åpne med meg, der er det skrevet om stoffet i seg selv. Vag, som hjelper til med alle slags osv..
Generelt lagt merke til, for oss er lite effektivt.

Jeg klarte å bestille litmus-papirer på Internett. Jeg fant heller ikke på apotek.


Adresse ikke lagret? Jeg skal være i Russland i august, jeg vil bestille en datter hvis de ikke sender til Kasakhstan.
Om te - hva hvis du drikker carlsil til leveren? I kjemi fikk vi beskjed om å drikke det.

Jeg kjøpte teststrimler her

Jeg tenkte på biler og noe sånt. Jeg skal gjenta AST og ALT 1. august og så vil jeg bestemme meg for å ta caril.
Jeg er generelt tapt, det er vanskelig og uvanlig at jeg blir behandlet. Forrige gang jeg ble syk i 2005 var kolecystitt. Den rennende nesen min varer 2-3 dager, ikke mer. Og så bukket hun under for samtalen om å gjennomgå en fysisk undersøkelse og fikk en diagnose. Derfor kan jeg ennå ikke forestille meg hvordan jeg skulle behandle, jeg studerte bare diagnosen som jeg ble gitt uttrykk for. Vel, jeg så etter behandlingsmetoder.
Jeg håper virkelig på dette
http://remedium.ru/news/detail.php?ID=62462)))))

Her har jeg studert hvordan min kollega i ulykke fra Australia ble behandlet. Tilnærmingen er interessant, systemisk. Det kalles gratis radikal terapi. Vi studerer kroppens biokjemi, ser etter svake flekker, avvik, på vedlikehold som immuniteten bruker sine viktigste krefter. Deretter behandles disse svakhetene, avvik fra normen. I dette tilfellet må du i utgangspunktet bestå en blodprøve minst 48! indikatorer. Jeg antar at ikke en eneste lege hos oss, og enda mer med deg, er i stand til å analysere et slikt antall indikatorer. Og for å kurere, ja, alternative metoder.
Generelt må vi sakte se etter måter å kurere oss selv på.

I år, i klassekamerater, møtte jeg tre kvinner med CLL. To bor i Ukraina. En av dem utstedte oppholdstillatelse i Russland og der tok hun et kurs i kjemi (fludara og cyklofosfamid), nå i remisjon. Den andre hadde hvite blodlegemer for rundt 30 to måneder siden, nå kan hun ikke komme til Donetsk for å ta tester på grunn av bombingen. Hun drikker brus, ikke noe mer. Den tredje bor i Moskva, og gjennomgår for tiden eksperimentell behandling på Blokhin-klinikken. I Tomsk ba de meg ta tid, jeg hadde ingen hastverk med behandling, fordi på tilnærmingen er tre medikamenter i de siste stadiene av testen, som har store forhåpninger om at CLL vil kunne behandles.
Her drar jeg. Jeg har ikke vært på sykehuset på 3 måneder allerede, fordi mine roper at jeg allerede legger meg på kjemi. Hun begynte å skrike så snart de hvite blodcellene gikk ut av normen og var 10,3. Hun kan ikke snakke rolig, men jeg vil ikke kaste bort nervene.
Takk for adressen!
Men MMS er veldig vanskelig å drikke..

Og hvilke medisiner har de snakket om??
Soda hjelper henne?

Legemidlene ble ikke navngitt. En kvinne som ikke kjenner navnet i eksperimentell behandling, sier heller ikke.
Den som drikker brus sier at hvite blodlegemer opprinnelig gikk ned med rundt 10 enheter og sto 4 måneder på plass. I hvert fall ikke økt. Men nå, i lang tid, besto jeg ikke analysen.
Fikk svar (angående salinomycin), og ba om et ekstrakt.
Jeg skal prøve å sende det jeg har. Uttalelsen vil ikke bli gitt til meg bare.

Fikk svar (angående salinomycin), og ba om et ekstrakt.

Hvilket utsagn. Og hvis en person ikke bor i Russland, kan det hende at det ikke er noen uttalelser i det hele tatt. Jeg tror det er nødvendig å beskrive diagnosen til dem, resultatene av analysen.. og spørre om de kan hjelpe. Hvor mye er og så videre.

Hvilket utsagn. Og hvis en person ikke bor i Russland, kan det hende at det ikke er noen uttalelser i det hele tatt. Jeg tror det er nødvendig å beskrive diagnosen til dem, resultatene av analysen.. og spørre om de kan hjelpe. Hvor mye er og så videre.

Så det gjorde jeg - jeg sendte resultatene fra alle analyser (OAC, biokjemi, cytologi osv.). Stilte spørsmål om pris, levering. Venter på et svar.

Så det gjorde jeg - jeg sendte resultatene fra alle analyser (OAC, biokjemi, cytologi osv.). Stilte spørsmål om pris, levering. Venter på et svar.

Ingen svarer meg.
I går var jeg glad for at MMS drakk normalt, og i dag igjen gjør det meg syk, selv magen knuser sånn. Vi må hvile fra ham igjen.

Og når vil du gjøre en kontrollanalyse?

I går tenkte jeg det om en uke, og i dag bestemte jeg meg for å passere det på lørdag for å sjekke MMS.

Avmelding så er det resultatet av slik lidelse)))

Vel, melde deg ut.
Resultatet glede meg overhodet ikke. Som med CML ser det ikke ut til at dette fungerer..
Hvite blodlegemer 60,2 (+20,2)
Lymfocytter 82 (= 10).

Kast, selvfølgelig, jeg vil ikke MMS (du vet aldri.). Forresten, hvis noen er fra Kasakhstan, kan jeg gi gratis for en test. Eller hvis jeg flyr til Tomsk via Novosibirsk i august, som vil prøve, tar jeg med meg.

Nå bestemmer jeg meg i en uke hva jeg skal teste videre og i kamp!

breganika, du skrev: "ASD, cardyceps, aconite ga positiv dynamikk."
Det kan være forgjeves forlatt?
Prøv hemlock, slik MikEB råder..

Gå til onkologisenteret i Tomsk?

breganika, du skrev: "ASD, cardyceps, aconite ga positiv dynamikk."
Det kan være forgjeves forlatt?
Prøv hemlock, slik MikEB råder..

Gå til onkologisenteret i Tomsk?

Hvordan MikEB råder, er jeg redd. Jeg ville prøve under tilsyn, og sånn.
Jeg lener meg mot ASD nå. Jeg begynner å drikke om en uke.
Jeg skal til Tomsk eller ikke, jeg vet ikke. Hvis legen ikke drar på ferie, vil jeg definitivt dra.

breganika, prøv å komme inn, gode anmeldelser om ham.

IMHO, du kan ikke kaste giftstoffer.

Det er mange måter å fremstille forbindelser fra hemlock på, så vel som metoder for anvendelse. Hver healer holder seg til sin egen. Det er selvfølgelig og vanlige måter inkludert i mange bøker..
Metoder foreslår å jobbe med både tørt gress og friskt gress. Den vanligste bruken av tørt gress.
Den grunnleggende oppskriften for skjær på tørt gress 10g urt per 100 ml vodka (alkohol foreslås i noen tilfeller), insister i en uke på et mørkt sted, så sil.
Denne skjæringen kalles 10%.
Denne skjæringen brukes i metoden til Tishchenko Yu.V..
Fra en til tjue dråper tas per dag med hemlock-skjær. I gjennomsnitt: to dråper per teskje vann fem ganger om dagen, et kurs på ti dager, en pause på 2 måneder.
Den samme skjær brukes i teknikken kalt "Royal":
Den mest populære, men utrygge teknikken er den "kongelige" sykkelteknikken. I Bibelen klager psalmisten David til Gud: "Med alle dine bølger har du slått meg." Det var med denne metoden jeg bestemte meg for å knuse hodet til den fordømmende fienden.

Om morgenen på tom mage, en time før måltider, gi et halvt glass vann en dråpe av infusjonen. I morgen, på samme tid, vil det allerede være to dråper - og slik at vi hver dag øker dosen med en dråpe per dag, går ut til 40 dråper, hvoretter vi, gradvis reduserer en dråpe hver dag, igjen kommer til en. Og det er derfor nødvendig å gjenta flere ganger til svulsten helt forsvinner. Samtidig får kroppen tilstrekkelig immunpotensial til å allerede uavhengig overvåke situasjonen i fremtiden.

Dette er en effektiv teknikk, og det er tilfeller der helt håpløse mennesker ble kvitt kreft - brystkreft, spiserørskreft, magekreft, leverkreft, og generelt kreft, undertrykkes av en hemlock ved denne metoden. Men erfaringer med pasienter antyder at ikke alle kan gjøre disse dosene og noen ganger begynner forverringene etter 25 dråper, og derfor er mitt råd om denne teknikken at det er bedre å ikke teste skjebnen, og svekkede pasienter skal ikke stige over 25 dråper. Naturligvis er disse doseringene gyldige for konsentrasjonen oppnådd under fremstillingen av skjær i slike proporsjoner som beskrevet ovenfor.

Hvis vi i begynnelsen av behandlingen har et fullstendig plantet immunforsvar, og idet vi var dømt, bare hadde skjær for hånden, og som plasserer våre svake forhåpninger, har vi, med å starte den andre syklusen, merkbare positive skift mot bedring - et anstendig immun potensial (hemlock forbedrer kvalitetsmessig immunforsvaret) og igjen den samme skjev hemlock. Men det viktigste vi har fått til på dette tidspunktet, er tillit til det valgte stoffet, og godt humør. Og det blir bekreftet i praksis.

Imidlertid er min vanligste teknikk, den sikreste og mest effektive, 15 dråper, hvor vi gradvis, som i første tilfelle, når vi øker til denne dosen, holder vi fast på dette antall dråper og går på det til fullstendig utvinning.

Med inoperable kreftformer og de siste stadiene brukes Nikiforov Yu.V.-ordningen: Begynn med fem dråper, og tilsett deretter en hver dag. Ta antall dråper til tretti. Etter det begynner vi å avta. Vi reduserer også en til fem. Pause i fem dager og gjenta kurset igjen. Altså tre kurs. Resepsjonen tre ganger om dagen. Fortynn dråper i vann - 50 ml.
Påfør den samme bladjuicen. Også i en dråpeproporsjon to dråper per spiseskje vann.

Dessverre kan jeg ikke gi en lenke til kilden, jeg kopierte for meg selv, her på forumet.

Gjennomgang av behandlingen

kan du avklare litt om deg selv: når sykdommen begynte å utvikle seg, hvor lenge varer den, hva er din fysiske tilstand, hvordan blir du behandlet, hva er humøret ditt, hva gjør du, hvor mye er du kjent med funksjonene i dette problemet? Har du fått cellegift og har du renset kroppen din siden den gang?

Diagnosen ble stilt i år, behandling med stoffet Gleevec, i begynnelsen av mottaket var veldig dårlig, nå er det normalt, men de har ikke lov til å fungere, men det er ingen x / t

Det er som det måtte være, du bør begynne å bekjempe dette problemet selv

dens videre utvikling skjer i forskjellige evigheter på forskjellige måter. Det er bra at vi klarte å fange den på det innledende stadiet. Med riktig oppførsel kan videre utvikling ikke bare bremses, men også stoppes. Jeg håper du vet det. Derfor må du bruke de samme metodene som pasienter bruker i andre former. For å komme i gang, se på dette emnet http://ykt.ru/cgi-bin/forum/iforum.isa?f=24&a=rx&id=238023 skriv, hvis du tror det er nødvendig, til sverdet eller e-posten. Jeg ønsker deg en rask bedring!

Jeg har en god venn med en lignende diagnose. Galina. Hun bor i Kasakhstan. Da jeg informerte henne om problemet ditt, svarte hun meg: ------------------ Boris, selvfølgelig, gi adressen min til denne jenta med CML, jeg kan hjelpe med hva, og hun kan Fortell meg noe. Det er tross alt få tilfeller med blod. Forresten, sykdommen hennes er spådd å være bedre enn min - CLL, lettere å behandle, slik at du kan roe henne ned. Hun har mye monocytter, jeg har lymfocytter. Ja, jeg skrev til deg om ernæring, fordi jeg gjorde sultedagen på onsdag, men jeg sluttet, jeg fant mye litteratur om at med leukemi kommer næringsstoffer fra blodet, i dette tilfellet under sult, tar syke celler dem først, fordi de er mer aktive, og sunne mennesker sulter og kan ikke oppfylle sin funksjon, nektet sult, men økte mengden "levende" mat - frukt, grønnsaker, uten kjøtt. Mengden hemoglobin steg til 149. Leukocytter vokser fremdeles litt, men det er ingen lymfocytter. (Husk at i Tomsk fortalte en healer at han stoppet prosessen, er det virkelig slik?). Jeg kan anbefale henne gebyrene som jeg nettopp har fått tildelt, de er alle for bloddannelse, bortsett fra dette, jeg trenger å rengjøre blodet mitt konstant (Tishtkoens anbefalinger) - oregano, furubuljong + løkskall + lakris + roseskjær, kastanjeblomster. Alterner disse avkokene etter 3 dager. Sabel (alkohol tinktur) hjelper godt. Å drikke en teskje 3 ganger om dagen (ikke superkjøl) - jeg prøvde det på meg selv. Nok en alkohol tinktur av skallene av sedertre nøtter - også 3 ts. på en dag. ------------------ Så hvis du ønsker å korrespondere, vil jeg fortelle deg adressen til Galina.

Onkhematologisyklus. Del 1. Kronisk lymfocytisk leukemi.

Hei alle sammen! Leser Picabu, jeg la merke til at mange brukere er aktivt interessert i emnet onkologi, ikke sant? Og jeg bestemte meg for å prøve å skrive en relativt liten syklus. Siden jeg foretrekker temaet Onkohematologi mer, vil jeg skrive om det (hvem jeg bedrar - jeg vil ganske enkelt skrive om utdrag fra smarte bøker i en form som er tilgjengelig for en enkel gjennomsnittsmann).

Jeg skriver klassikere, uten for mye vitenskap. Noen data kan bli supplert eller til og med tilbakevist (MÅ IKKE ?!)

Hvorfor kronisk lymfocytisk leukemi (CLL) kommer først?

Dette er den vanligste typen hemoblastose (blodkreft, deretter GB), statistikk vil fortelle deg at nesten 30% av all GB er CLL. Hvis du bor i det post-sovjetiske rommet, vil omtrent 5-7 personer bli syke per 100 000 innbyggere i byen / byen / akvariet i løpet av et år. Ikke hastverk imidlertid med å begynne å telle sannsynlighet så raskt. Gjennomsnittsalderen for begynnelse av CLL er omtrent 65 år, inkl. ikke alle av dere vil leve opp til så mange år: D

Så hva er poenget? Hva forårsaker CLL??

Det er mange teorier - hvis i et nøtteskall (nesten):

Vi består av celler, og i hvilke celler, hvis ikke i benmargsceller, er kromosomer?

Ja, saken er i kromosomene. Spesielle seksjoner utmerker seg i disse kromosomene, lange og korte skuldre er viktige for oss nå.

På alle disse skuldrene skilles igjen spesialiteter. seksjoner, som hver er ansvarlig for et bestemt gen, protein, for noe annet - disse seksjonene i vitenskapen er vanligvis bare nummerert. Vi legger til kunnskapen om at mutasjoner konstant forekommer i kroppen (som heldigvis er korrigert eller ødelagt, dette er normalt vurderer vi patologi), og allerede med akkumulering av et stort antall mutasjoner i visse områder vil den aller eneste smertefulle lymfocyttforløperklonen oppstå. Denne klonen begynner å formere seg, utvikle seg til en mer eller mindre moden tilstand (fra dette, forresten, ordet "kronisk" i navnet, og ikke fra det faktum at dette er en sykdom hos en person i lang tid, akutt lymfocytisk leukemi kan også være i lang tid, men cellene i dette tilfellet ung og underutviklet) og vokser, fanger flere og flere områder av benmargen, hvoretter de kommer inn i det sirkulerende blodet og påvirker andre organer og vev (i det minste er denne teorien ansett som den viktigste for øyeblikket).

Ta en teoretisk person som allerede har 100% av denne plagen.

Hva vil skje i etapper ?

Flere stadier av sykdommen kan skilles..

Fase 0 - manifesterer seg ikke eksternt, men med en tilfeldig tatt blodprøve kan du allerede se et økt nivå av lymfocytter (det absolutte antallet LYMPHOCYTES (ikke hvite blodceller generelt, nemlig individuelle lymfocytter) på ett glass er større enn 5,0x10 ^ 9). Prognosen på dette stadiet er god - mer enn 10 år.

Fase 1 - du kan merke en økning i lymfeknuter (> 1 cm) i hele kroppen, en endring i formen på lymfeknuter fra oval til rund, fortetting, lymfeknuter kan være klynger, et kjennemerke for de fleste (unntatt kronisk sirkulerende) infeksjoner - de er smertefrie. Ofte er det en økning i temperatur, svakhet, hyppige infeksjoner. Prognosen er fremdeles ganske god 7-10 år.

Fase 2 - Milten øker kraftig (ofte sammen med leveren) + 1 trinn. 5-7 års prognose.

Fase 3 - Det er en svakhet, som forklares med en stor nedgang i hemoglobin (

Hvilken spesiell diagnose ?

Benmargsstikk med en vurdering av kvaliteten og antall celler, en generell blodprøve, DNA-studier (PCR), immunhistokjemiske studier, flowcytometri. Forskning, hvis interessert - vil måtte google, fordi her hver studie fortjener et eget, hvis ikke et, innlegg.

Alt er blått - de ønskede lymfocytter, det er for mange av dem.

Behandling? (Jeg ser ikke poenget med å beskrive ordningene og egenskapene til enkeltmedisiner, fordi du glemmer det likevel)

Nå brukt: cellegift + monoklonale antistoffer mot etiketten (CD20 - navnet på denne etiketten) av lymfocytter, oftest er det RituxiMAB / MabThera og andre antistoffer som ender på -MAB) + om mulig er benmargstransplantasjon utmerket (studier sier at dette er ekstremt effektivt).

Generelt forløper sykdommen stabilt, med unntak av tilfeller av enda større malignitet ved Richter syndrom og transformasjonen av kronisk lymfocytisk leukemi til akutt lymfocytisk leukemi (navnet på denne transformasjonen er eksplosjonskrise).

Jeg vet at jeg utelot mye, skrev mye forenklet og fremdeles prøvde jeg å formidle den grunnleggende informasjonen til en enkel lekmann.

I alle fall - kommenter, angi feil, treff med tøfler for staving og tegnsetting, indikere unøyaktigheter i materialet - vi vil lære nye ting sammen.

Takk for at du leste :)

Ingen duplikater funnet

Hei. Så kan jeg ha hll? Lymfocytter vokser hvert år og nøytrofiler faller. Lymfocytter i% 65 med en hastighet på 40, og nøytrofiler 28%.. Arochai tar ikke tiltak (

Hvor ellers kan jeg kaste en eik? Det faller ikke av.

Hallo, la oss kaste av eiken som jeg overrakte fersk til legen for en måned siden, men på mandag skal jeg gi den til meg selv. Ikke ta av, de skriver litt rangering (.

I det første trinnet er økningen ikke i det absolutte antallet lymfocytter, men i den relative, dvs. som en prosentandel av det totale antall leukocytter. Dessverre har den nesten ingen diagnostisk verdi, fordi økte lymfocytter i leukoformula (mer enn 37% hos voksne) kan ha veldig forskjellige årsaker.

Nyheter nr. 1011: Norske biologer lærer å bestemme kyllingberedskap

Nyheter nr. 1010: Baker-gjær lærte å produsere psilocybin

Hvordan muterer coronavirus og hvor ille er det? Vi ser på virkelige eksempler

Kjedelige tider har lenge kommet for de som leste science-fiction bøker fra 1970-tallet om tekniske disipliner i barndommen: du kunne lese om en Higgs-boson eller trekk i hendelseshorisonten til et ladet roterende svart hull for et halvt århundre siden. I dag er biologi et område hvor det er vanskelig å spore fremgang. Og hvis runet er fylt med materialer på tekniske fagdisipliner, som er tradisjonelt for Russland, så er biologi og bioinformatikk ekstremt dårlig representert.

I løpet av de siste 18 årene har kostnadene for sekvensering av det menneskelige genom falt hundre tusen ganger til 1000 dollar. Lengden på det humane genomet er tre milliarder nukleotider, og genomet til coronavirus SARS-CoV-2 består av bare 30 000 nukleotider. Gitt billigheten og relevansen, har mange koronavirusgenomer allerede blitt sekvensert og gjort offentlig tilgjengelig.

Coronavirus genomet er så kort at det kan åpnes som en tekstfil i en notisbok, og forskjellene i nukleotidsekvensen til to forskjellige genom er synlige for det blotte øye.

Du kan laste ned genom med en knapp i GenBank, det er også et innledende referansegenom fra desember 2019 fra kinesiske Wuhan. Genomet er en sekvens av bare fire typer nukleotider - A / G / T / C, det vil si adenin, guanin, timin, cytosin. Følgelig, i tillegg til minimumsfortellingen og en haug med bokstaver A / G / T / C, er det ingenting der. Kanskje er dette et av de sjeldne tilfellene når det å samle data for analyse tar kortere tid enn selve analysen.

Genene til coronavirus. Til venstre er det "første" genomet fra kinesiske Wuhan fra 2019, til høyre for 24. mars 2020, hentet fra en av de smittede i USA. Begynnelsen på det første genet i genomet fremheves med blått. For enkel visning er sekvensen delt inn i kolonner med samme bredde.

Heldigvis er det allerede bygget et genomkart og nukleotidsekvensene til alle genene til coronavirus er kjent. For eksempel koder det første genet orf1a-proteinet, dets første 21 nukleotider er: ATGGAGAGCCTTGTCCCTGGT - bare funnet og fremhevet på skjermdumpen. Når du kjenner til de innledende og siste delene av genene, for ikke å nevne hele genene, er det lett å markere genomet og forstå hva som er hva i dette tilfellet av coronavirus.

Noen deler av genomet er ikke inkludert i noe gen - det er søppel-DNA (RNA), som ikke har arvelig informasjon og kan mutere (endre) når det vil uten skade og fordel for viruset. Uønsket DNA dannet hullene mellom genene, så vel som starten og slutten av genomet. På bildet over er de første linjene bare søppel-DNA, og for eksempel stemmer ikke den første linjen.

Siden genomet i alle dets deler egentlig er det samme settet med bokstaver A / G / T / C, kan du for enkelhets skyld analysere fokusere på delen av genomet - på et hvilket som helst gen.

For penetrering av viruset i cellen er ansvarlige proteiner (s-protein), som ser ut som en pigg på overflaten, og danner sammen selve “kronen” som ga navnet til denne typen virus. Det er disse proteinene vaksinene som nå skapes er rettet mot å stoppe spredningen av epidemien..

Hvis s-protein muteres raskt og sterkt, vil ikke vaksiner følge med nye mutasjoner, som i tilfelle av sesonginfluensa. Hvis sakte vil en vaksine redde menneskeheten fra problemer i lang tid.

Mutasjoner av genet som er ansvarlig for koding av s-protein, vil vi vurdere.

Skjematisk illustrasjon av et koronavirus. S-protein er merket øverst til høyre

Fra ord til nukleotider

Hele genomet til coronavirus er omtrent 30 000 "bokstaver". Nukleotidsekvensen til s-proteingenet er kjent, det er totalt 3822. For eksempel de første femti:

Her er de siste femti:

Hvis, som Michelangelo, i hvert genom kutter av alt før disse første femti bokstavene og etter de siste femti, gjenstår s-proteingenet. Ved å plassere hvert gen i en Excel-streng, er det praktisk å legge merke til mutasjoner. I skjermdumpen nedenfor har for eksempel noen Hong Kong-smittede personer i 22. plassering G i stedet for den vanlige T:

Et skjermbilde med generelle data om genomet og den innledende delen av s-proteingenet. Piler indikerer mutasjoner (utskiftninger) T -> G

Et genom eller et enkelt gen er ganske enkelt arvelig informasjon. I følge denne informasjonen er det som kommer til å fungere i fremtiden protein (1 gen -> 1 protein). En mutasjon i et gen er vanligvis, i vårt tilfelle, en erstatning av en "bokstav" med en annen. Noen mutasjoner i genet fører til endring i proteinet, andre ikke. Noen endrer proteinet svakt, noen sterkt, noe som sannsynligvis vil føre til funksjonshemningen av viruset, siden proteinet laget av det sterkt muterte genet vil være feil og ikke vil være i stand til å utføre sine funksjoner. På den annen side kan det hende at en vaksine designet for den forrige "versjonen" ikke virker mot et endret protein.

Gå gjennom syklusen gjennom alle genomene, finn s-proteingenet og se etter erstatninger i forhold til den første versjonen fra 2019; dette er flere titalls linjer med enkel programmering.

Tradisjonelle lineære eller søylediagrammer er ikke egnet for å vise 3822 nukleotider og deres substitusjoner. For klarhet er det mer praktisk å ordne nukleotidsekvensen som tekst, fra venstre til høyre, fra topp til bunn, og erstatte tilstedeværelsen av mutasjon og deres nummer med fargen på feltet:

Farger indikerer antall varianter for et gitt "brev" blant de analyserte genomene. For eksempel betyr gult at for et gitt nukleotid er det alle tre mulige varianter av en mutasjon, og hver av dem fører til et litt forskjellig proteinmolekyl. Hvis det bare er en mutasjon for en bokstav, og at mutasjonen er ufarlig, er fargen nærmest den første fiolette.

Daglig animasjon:

Mutasjoner er mildt sagt til stede, ikke en eller to, og de fleste er ikke synonyme. Det vil si de som modifiserer proteinet fra coronavirus. Men mye eller litt i sammenheng med en virusmutasjon og vaksiner?

Forskere sier at SARS-CoV-2 coronavirus muterer relativt sakte. For eksempel muterer sesonginfluensa mange ganger raskere. Det vil si at det kan forventes at vaksiner som allerede gjennomgår kliniske studier på mennesker i syv laboratorier, vil være relevante og effektive over lang tid. I så fall venter vi på vaksinen! =)

Ulver og harer i grafikk og portretter

Det hender at strålende ting kommer på hodet til to personer på en gang. Hvordan skjer dette? Hvorfor dem? Ingen svar. Men som et resultat av slik hjerneaktivitet foreslo amerikanske og italienske matematikere en modell for interaksjon "rovdyr - byttedyr". De kranglet ikke og forbannet om den som er mer genial for dem, tankene til deres tanker bærer navnet på begge: Lotka - Volterra-ligningen.

Det er rovdyr, det er ofre. Hvorfor er det noe slikt? Med mindre dette selvfølgelig er rovdyr fra en serie filmer med samme navn. Tenk på det. Det ser ut til å være åpenbart at et rovdyr spiser ofre, for at de er ofre. Selv slike noe spontane fenomener kan imidlertid forklares matematisk.

Vurder det enkleste alternativet. I rollen som et rovdyr vil det være ulv, i rollen som et offer - harer. Harer griper planter. Alle dyr lever i et begrenset område, men gresset har tid til å vokse, slik at ørene ikke lever i fattigdom. Fjern nå kvinner, barn og besvimelse av hjertet fra skjermen. Vi starter med at antall harer refererer til antall ulver 3: 1. Systemet lever, harene hopper, og ulven mater beina. Begge populasjoner vokser og gleder seg over det hypotetiske livet. Da når antall rovdyr et visst tall, de, som enhver organisme, fôrer, antall harer minsker. Saken er at forbruket blir så stort at befolkningen rett og slett ikke har tid til å komme seg. Forresten, ikke all energi går til rovdyr fra en hare, men bare 10%, derfor spiser en ulv flere harer. Når mat blir knapp, er det bare logisk at rovdyr begynner å dø. Dette fortsetter til antall ofre kan nå det nivået som befolkningen vokste. Til nå avtar rovdyr. Men så går både ulv og harer til vekst. Og bestander vokser igjen, solen skinner, livet er vakkert. Og så er det mange ulver, de spiser harer, det er få harer, ulver dør også. Har du allerede sett dette et sted? Jeg vil fortelle deg hvor: noen få linjer tilbake. Det er ikke at det er en groundhog-dag, alt utvikler seg bare syklisk.

Og hvordan er dette relatert til en datamaskin? Et program som data for Lotka-Volterra-ligningen drives inn i, kan bygge grafer som faktisk vil formidle fortellingen min. Du kan se grafen til funksjonen, faseportrettet, som er en konsentrisk lukket kurve rundt et stasjonært punkt, og fasebanen - samme faseportrett, bare 3D (se graf 1)

I tillegg til et slikt idealisert system, kan det gjøres redigeringer. Du kan for eksempel legge til et konkurranseelement i samme visning. Har du noen gang tatt den siste cookien fra en pakke? Og ulv kan bite hverandre. Og harer kan bruke sitt eget avkom. Sånn er livet. Men bildet kommer mer interessant ut. På grafen er ikke svingningsfunksjonene de samme, amplituden deres synker til en viss mengde etter hvert som antall rovdyr og rovdyr synker, fordi intraspesifikk konkurranse i tillegg reduserer antallet av hver art til antallet av begge typene når et visst antall, der dyr kan spre seg over territoriet slik at intraspesifikk konkurranse ikke vil ødelegge dem så mye. I faseportrettet vil dette ikke se ut som en lukket kurve, men som det vi ser, drenering av vannet, vil alt ha en tendens til dette stasjonære punktet, poenget med likevekt og fred. (se grafer 2)

Hvis starten på vårt hypotetiske system bare var det stasjonære punktet, ville alt være omvendt: populasjoner ville vokse. På grafen ville amplitudefunksjonene øke over tid, og i faseportrettet ville den rette linjen ikke snurre til sentrum, men snurre fra den, og illustrere populasjonenes vekst. (se graf 3)

Det er andre modeller som ikke er så utsatt for endring. Slik er Holling-Tanner-modellen. Hvis vi for eksempel tok en annen holdning til ofrene til rovdyr, hvis de for eksempel var like delt, ville systemet forsøke å gå tilbake til en stabil tilstand. Over tid vil harer i forhold til ulv bli 3: 1. Hvis vi hadde nøyaktig to harer og to ulver, ville en rovdyr åpenbart ikke ha nok ofre. Men harer raser raskt. Til tross for at de blir spist, vil befolkningen fortsatt ha tid til å vokse. Og da ville systemet komme til det som ble beskrevet tidligere. På grafen vil vi se en økning i amplitude, og deretter jevn, identiske perioder. Og i faseportrettet har slike modeller begrensingssykluser. Linjen ville spinne fra punkt 2; 2 til denne grensesyklusen. En rett linje fra et stasjonært punkt 3: 1 ville bli vridd til en syklus. (se graf 4)

Hvis vi antar at parametrene i ligningen ikke er konstanter, men koeffisienter som er avhengig av antall ofre, vil bildet være annerledes. Vi tar to parametere som er omvendt avhengig av hverandre. La det være rovdyrets metning og dens avlshastighet. Hvis metningen er høy, trenger kaniner mindre. Siden det er et omvendt forhold mellom parameterne, er avkommet til ulv tregt. Begge populasjoner vil deretter gradvis avta for å stabilisere seg på et nivå som ikke er null. På grafen vil amplituden avta, på slutten vil det være nesten en rett linje. Faseportrettet illustrerer det samme: linjen vil krølles opp til noe ikke-nullpunkt stabilt for systemet. (se graf 5)

Så når du ser på grafene, kan du "lese" hele populasjonens historie. Dette er veldig spennende. Det er interessant at modellene ikke bare kan brukes i forhold til dyr, men også til økonomi, politikk, næringsliv. Du kan til og med arrangere spåvisning på grafer i henhold til Lotka-Volterra-ligningen. Hva er ikke et alternativ til kaffegrut? Enda mer pålitelig.

Den første deteksjonen av dinosaurproteiner og DNA

Vi hadde ikke tid til å le av de falske nyhetene om opprettelsen av et T-rex-embryo fra et kyllingegg, som en vitenskapelig artikkel av Alida M. Bailleu et al., Med tittelen "Bevis på proteiner, kromosomer og kjemiske markører av DNA i usedvanlig bevart dinosaurbrusk "-" Tegn på tilstedeværelse av proteiner, kromosomer og biokjemiske DNA-markører i eksepsjonelt godt bevart dinosaurbrusk "gir bevis på bevaring av proteiner og nukleinsyrer i en dinosaurprøve Hypacrosaurus stebingeri (illustrert) omtrent 65 millioner år gammel. https://academic.oup.com/nsr/article/doi/10.1093/nsr/nwz206/5762999

Fig 1. Utseende av Hypacrosaurus stebingeri dinosaurprøver og en kontrollprøve (moderne Emu-struts) mikroskopisk deteksjon av gjenstander som ligner kromosomer og delende celler.

A. Generelt syn på en prøve av Hypacrosaurus (MOR 548) av livmorhalsen. B. Mikrografikk av forkalkede bruskfarvede lakuner. C-D-strukturer som ligner delende celler og dinosaur-kromosomer under høy forstørrelse. E. En kontrollprøve av livmorhalsen til den moderne Emu-struts. F. Bruskvev fra kontrollprøven. G-celler frosset i prosessen med deling og kromosomalt materiale i kontrollprøven.

Fig 2. Alkisk blå farging (bruskmarkør) av skiver av en dinosaur og et strutsstrutsprøve.

Utseende av prøver av A. bruskvev i en dinosaur og B-bein fra en dinosaur. Alkisk blåfarging av brusk C avslører en blå flekk (typisk for kondrocytter, bruskceller). D. Minimal farging av dinosaurbeinet med Alcian-blå. E-H-kontrollprøver av emu-struts viser også knallblå flekker av brusk og minimalt med bein.

Dette resultatet viser at i prøvene brusk av dinosauren egentlig ikke er noe annet vev.

Fig 3. Deteksjon av DNA i kondrocytter (bruskceller) fra dinosauren Hypacrosaurus stebingeri

Dinosaur bruskceller (A-B), propidiumjodid (C) og DAPI (D) farging for DNA / nukleinsyrer. (E-G) Emu Strutskontroller.

Fig. 4. Påvisning av Chick Collagen II-protein i materialet i brusk av dinosauren Hypacrosaurus stebingeri

A-D. Immunfluorescensanalyse av antistoffer mot Chick Collagen II-protein (grønt signal) i ultratinseksjoner av Hypacrosaurus stebingeri-materiale og brusk av moderne emu-struts (E-H). For å bekrefte at dette er kollagen II, behandlet forfatterne dinosaur (C-D) og Emu (G-H) strutseprøver med kollagenase II som spesifikt spalter kollagen II og mottok den forventede reduksjonen i signalintensitet. For å bekrefte at dette er kollagen II, og ikke noe annet protein som antistoffer binder seg ikke spesifikt, farget forfatterne de samme prøvene med antistoffer mot kollagen I som normalt ikke er tilstede i bruskvevet og ikke mottok et signal. Supplerende materialer til artikkelen gir også kontrollfarging uten antistoffer mot Chick Collagen II for å utelukke uspesifikk farging av prøven med sekundære antistoffer med en fluorescerende markør (grønn kromofor) som spesifikt binder til primære antistoffer mot Chick Collagen II, mangelen på signal i kontrollprøven bekreftet at virkelig Chick Collagen II og ikke et tilfeldig fenomen.

Etter å ha lest artikkelen, vil jeg fra min personlige kritikk veldig gjerne se farging av propidiumjodid- og DAPI-prøver som kromosomer er synlige på (fig 1), begge fargestoffer bør farge dem. Imidlertid er det sannsynlig at kromosomer frosset under delingsprosessen kan gjennomgå større nedbrytning enn celler pakket i kjernen og bare overleve eksternt uten innholdet av nukleinsyrer. Når det gjelder utseendet til det beisede materialet, er det akkurat slik cellekjernene ser ut. Jeg kan ikke unnlate å merke meg at dinosaurkjernen ser mye mindre ut enn den normale kjernen i en vanlig celle av moderne pattedyr, i forholdet mellom størrelsen på kjernen og cellen, men siden vi har å gjøre med en så gammel prøve millioner av år gammel, kan den lille størrelsen være assosiert med nedbrytning av nukleinsyrer i prøven..

Disse resultatene vekker tvil om den publiserte i 2012 av Morten E. Allentoft et al., Antakelser om en halveringstid av DNA på rundt 500 år og den grunnleggende umuligheten av å isolere og studere dinosaur-DNA. https://royalsocietypublishing.org/doi/full/10.1098/rspb.2012.1745. Fra oppdagelsen av nukleinsyrer, til det fullstendige eller i det minste delvise dinosaurgenomet, er selvfølgelig et enormt klynge. Likevel er det logiske neste trinnet å kutte ut kjernen i cellene fra prøven med en laser og prøve å trekke ut DNA for den genomiske sekvensen og innrette seg med referansegenomet til fugler, den samme strutsemoen. Hvor ofte i arkiver er bilder av konservering akseptable for isolering av proteiner og nukleinsyrer og under hvilke forhold prøven befant seg, noe som gjorde det mulig å identifisere proteiner og nukleinsyrer krever ytterligere studier.

Nyheter nr. 1002: Flaggermus senket stemmen for bananer

Nyheter nr. 1001: Sjøhester tilpasset graviditet som mennesker

Avreist (del to. Hvem er du. Jeg ringte ikke deg. Permisjon.)

Oooh. Først nå skjønte jeg hva slags hyggelige karer jeg skrev alle de tidligere innleggene. Jeg vil bøye seg for alle i bena, for alle, fra plesiadiscript til alle slags homoer. Barna var snille og ansvarlige. Her har du slike bein, men andre, se her, en nesten solid hodeskalle, men gå gjennom dit, grave rundt, det er et nesten uberørt skjelett for deg.

Takk til de homo sapiens som virkelig tilsvarer dette navnet, til forskere - kokt. Alt undersøkt, alt beskrevet (jeg vil ikke legge vekt). Jeg begynte å fortelle, glemte noe eller visste ikke - det er ikke noe problem! Han tok en bok fra sokkelen, leste det nødvendige kapittelet, så på et par forelesninger om opplæringen, stirret på bildene på det tematiske nettstedet og gå videre, skriv og juble! Takk til dem alle.

Det er bare ikke alle kattene Shrovetide.

Hvem er mr. denisovets?

Denisovans (homo heidelbergensis of Asia) er tre heftige tenner og et stykke finger, som dette.

Et stykke falanx av lillefingeren (til høyre, hvis det.):

Det er en vogn og en liten vogn i Denisova Cave (derav navnet), problemet er at alle slags skapninger bodde der i 300 tusen år, Denisovans, Neanderthals, Sapiens, deres mestizos og helvete vet hvem annet. To tenner, nå omtalt som Denisovans, ble funnet tilbake i sovjettiden, under den store utryddelsen av generalsekretærene, og har lenge blitt beskrevet som "neandertalaloider." De ville ha beskrevet det nå, sannsynligvis på samme måte, men nylig har de endelig lært hvordan de skal jobbe, og genetikkens herrer har begynt å gi reelle fordeler, utseendet til Denisovs mann er deres fortjeneste. Og selv om den klassiske paleoanthropologen egentlig ikke liker å trekke konklusjoner bare på bakgrunn av det ekstraherte DNA, er det i dette tilfellet rett og slett ingen annen måte.

OK, jeg kommer ikke ut lenger, jeg ville om dette helt på slutten. For mindre enn ett år siden studerte og beskrev våre kinesiske venner endelig denne tingen som ble funnet for lenge siden i Tibet. I. Ingenting, spesielt forandret.

Stor kjeve med store tenner. I tillegg klarte smarte mennesker å rekruttere noen proteiner fra det, trekke ut DNA fra dem - og, voilà! Denisovsky mann, hei, kjære! Det er fremdeles en interessant hodeskalle fra noen Huimulundun, eller hva det er, men det er ennå ikke studert ordentlig, det er ikke klart hvem vi vil vente på. Det vil være mange late som nå, kinesiske antropologer vil snart slutte å motstå (de forventer fortsatt moderne mennesker fra Asia, men unnskyld, jeg vil svare dem med det berømte ordtaket til Vadim Yevseyev. Nei, jeg vil ikke, plutselig som ikke er atten). Om et år, fem eller ti, vil Vangyu kunne snakke om Denisovans like trygt som neandertalere, for i Kina er det blitt gravd mange ting, ikke engang gravd opp lenger, og Tibet har holdt seg nesten uberørt til nå.

I mellomtiden har vi vitenskapelige konklusjoner.

En gang i tiden kom noen av homo erectus ut av Afrika, hvorved de fratok seg muligheten til å bli rasjonelle mennesker (homo sapiens), men de var i stand til å gyte forskjellige parallelle humaniora, og hvor mange av dem vi ikke aner om, ingen vet.

Det er tydelig at de som rømte fra Afrika begynte å utvikle seg i en litt annen blodåre enn våre direkte afrikanske forfedre, og på et tidspunkt ble de som forlot og flyttet til høyre forskjellige arter og i forhold til hverandre. Genetikk er en ung og uerfaren vitenskap, tallene er forskjellige, deretter 700 tusen år, deretter 500 tusen år, deretter et annet antall tusenvis av år, kort sagt, fra starten forlot de oss, og deretter koblet fra hverandre. Tatt i betraktning at kirdyk kom til alle, kan vi med sikkerhet si at det var nødvendig å være hos oss, og ikke vike fra noe sted.

Dessverre er genetikk nesten ikke i stand til å gjenopprette utseendet til Denisovs mann, for nå er det bare tydelig at de hadde store tenner og kjever, mørkt hår og øyne, og huden deres var også mørk, mest sannsynlig.

Men det genetikere elsker og vet hvordan de skal gjøre, er å se etter urenheter. De sier at du ikke en gang kan mate dem, la oss bare finne litt urenhet. Og en blanding av Denisovan hos mennesker ble selvfølgelig også funnet. Følgende par forslag, jeg anbefaler på det sterkeste mot å lese for rasister, Ku Klux Klanites og andre fans av hvit makt, ikke anten din fyr. Så, basert på det menneskelige genomet, er de eneste gjenværende purebred sapiens på planeten afrikanske svarte, som etter forfedrenes påbud fortsetter å henge med i Afrika. Vi, det store flertallet av verdens befolkning, har et stykke av det neandertaler genomet i oss. Men papuanerne, australske aboriginerne, noen melanesere, noen sørkinesere og noen andre innbyggere i Asia-Stillehavsregionen, tilsynelatende eskimoer, bærer arven fra både neandertalere og denisovanere. Halv-avler pannekake, hehe.

Vel, da går geografi, kronologi og logikk inn i slaget. Jeg vil kalle det "MTK" (vitenskapelig poke-metode). Jeg oppfordrer deg til ikke å forvirre denne metoden, din ydmyke tjener, med hans hjelp, mer enn en gang overlevert fysikk, inskripsjonen og andre perverse gåter for superintelligensen (nei, beskrivende geometri - ved juks. Skribent. Ugh, jævla det her.).

Så hva har vi? Blandingen med sapiens skjedde tilsynelatende et sted sørøst i Eurasia (India, Sør-Kina, Indonesia), og vi gravde opp deres patetiske biter i Altai, hvorfra det konkluderes at habitatet til Denisovs mann fra Altai (den russiske føderasjonens grense, Kina og Mongolia) til Indonesia, de filippinske øyene, generelt, hele Øst-Asia. Og da er Denisovittene våre, som er fra Denisova Cave, sannsynligvis elendige tapere, drevet ut til nordkanten. Dessverre kan ikke DNA isoleres fra de mer sørlige funnene, det ble lagret også i et varmt klima, og de er oppnådd, deretter sapiens.

Basert på denne geografiske logikken prøver moderne antropologer å binde Denisovans til synanthropes (foreløpig en underart av homo erectus).

Men synantropene er eldre, og tennene er mindre. Ble tennene større? Forskjellige typer? Stort intraspesifikt mangfold? Ukjent. Vi har ikke DNA fra synanthropus, vi har ikke en hel hodeskalle fra Denisovs, vi har ikke et helt ansikt fra heller, damer og herrer, graver pinner i hendene, hendene i beina og graver, graver og igjen grave. Øyegenetikk under et mikroskop og også arbeiten, schnelle-schnelle. I mellomtiden vil vi, som alle andre, vurdere Denisovittene etterkommere av synanthropene.

Generelt sett, i motsetning til Europa, revet over og over og til og med Afrika, må vi fortsatt studere og studere Asia. Gitt avstanden og mangfoldet i miljøet, hvor mange mennesker vi vil finne der og hvordan de vil være relatert til hverandre, kan man gjette til de er blå. Kort sagt vil jeg hekte et par øyboere.

Og folket fra Ngandong vil være den første, navnet normalt for dem er ikke til stede ennå. Det er tydelig at dette er etterkommerne av erectus som har nådd øya Java, jordens daværende kant. Ngandongene tilskrives enten erectus eller sapiens, og de kan også være Denisovans, hvorfor ikke? Faktum er at forfedrene nådde Java fremdeles ved land, for en million eller halvannen million år siden, da steg havnivået og falt, men få kom fra siden, så Ngandonerne utviklet sin egen måte i hundretusenvis av år.

Og de utviklet seg til flere veldig spesifikke tegn som ikke finnes i andre fossile kamerater. I henhold til etablert tradisjon vil jeg ikke bry meg om det unike ved fraværet av de bakre artikulære prosessene i det temporale beinet og andre occipital condyles. Veksten til en av individene ble etablert, omtrent 1,65 m - veldig middelmådig. Det gjennomsnittlige hjernevolumet for alle hodeskaller er 1100 cm³ - middelmådig og kjedelig.

Det er interessant at alle 14 fragmenter av hodeskaller, og flere bein ble funnet, faktisk, på ett sted, her inkluderer fantasien, gå feilen! Hjernespisende kannibalfest? Ukjente boschoer hang rundt omkretsen? Ja, det kan veldig godt være, gitt skaden på hodeskallene. Men det kan ikke være, med tanke på at denne skatten ble funnet på elvebredden, i svært blandede lag. Hvilke steiner banket på dem? Hvilke dyr gnagde dem? Ukjent.

Har Ngandongchans satt noen preg på den moderne mannen? Noen vestlige lærde prøver å knytte dem til de australske aboriginene, men det ordner seg ikke, vel, beklager, Mikhail Zadornov forlot oss, han ville raskt bevise at disse menneskene fra Ngandong, dette er moderne mennesker fra Hong Kong, og ville lukke emnet. Ngandongchins var veldig spesifikke karer, det var ingenting som oss, de døde ut, det virker som om lenge før sapiens ankom, noe som ikke er overraskende, isolasjon fører sjelden til noe bra (jeg snakker om evolusjon, hvis det).

Og best av alt, utviklingsforsinkelsen isolert, demonstreres av våre siste helter i dag, homo floresiensis, han er en floresque mann, han er også en hobbit fra øya Flores (for 50 - 100 tusen år siden).

Først for rundt en million år siden seilte de til Flores, det var de som seilte, tilsynelatende fra øya Java, vanlige pithecanthropuses, lokale ereksjoner, de ble også funnet, alt er i orden, men da, under de lukkede forholdene på en liten øy, begynte moroa.

Evolusjon på øyene elsker i prinsippet å være rare, for eksempel å øke noen til gigantisme.

La oss si at Kakapo-papegøyen, så stor for en papegøye (opptil fire kg i vekt), at jeg glemte hvordan jeg skulle fly.

Og på de samme Flores bodde han med hobbyene og lever fremdeles Komodo-øgelen, den største øgelen i verden. Jævla dinosaur er i stand til å veie opp til 100 kg, og være opptil 2,5 meter lang. Med tanke på at små krokodiller, villsvin, hunder, storfe og så videre inngår i dietten til brente dinosaurer, tror jeg at innbyggerne i Flores led av dem, på ingen måte lurer rundt.

I det siste har ting gått verre for dem, gjett hvem som kveler dem og erstatter dem?

Øyevolusjonen sender andre i motsatt retning og spiller et spill med dem - hvem er dvergen her? Vanligvis er de ikke heldige med artiodactyls, varmblodige rovdyr og proboscis, jeg vet ikke hvilken av dem evolusjonen refererte ankomster av Pithecanthropus, men litt mindre enn på en million år (enda mindre, mye mindre) krympet de spesielt.

Ikke noe redusert, men alt. Siden nesten et helt skjelett ble funnet i Liang Bois-hulen, blant annet, vet vi mye om dem. Jeg er glad for at det fra de første funn ble gjort antakelser og konklusjoner, som ble bekreftet av påfølgende funn i Mata-Menga, der de fant rester i alderen 650 - 800 tusen år, og de hører helt klart til mellomproduktet, mellom Pithecanthropus og hobbitene, arter. For eksempel er tennene allerede små, mindre enn vår, men strukturen er den samme som pithecanthropus. Det samme med kjeven og hodeskallen som helhet. Raskheten av isolert evolusjon er interessant, for en million år siden - den vanlige Pithecanthropus, som alle andre, og etter tre hundre tusen år, eller enda mindre, er dverger. Tørking bekreftes av verktøyene som ble funnet, hvis de første som ankom hadde gode, fullstore hakkere av den Acheulean-kulturen, som alle andre, hadde senere lag allerede små flak. Men fordi hendene har gått ned!

I gjennomsnitt var veksten til det florentinske folket en meter, kanskje litt større, en bred nese, en kjeve uten hakeutstikk, generelt er hodeskallen mer som den tidlige homoen, lenge utdødd langt i Afrika. Veldig lange armer, og proporsjoner av lemmer generelt, som Australopithecus! Australopithecus bl. 2 millioner år siden levende! Og jenta (hele hobbitskjelettet - den kvinnelige) er under hundre tusen år gammel. Håndleddet er helt ulikt noen. Ja fiken med dem, med lemmer, vet du hva annet var på Australopithecus-nivå? Hjerne. 400 - 450 gram. Som moderne sjimpanser. 2 -2,5 ganger mindre enn forfedrene som seilte til øya. Dette er imidlertid ikke overraskende, Madagaskar flodhester, elefanter på Malta og andre dvergøyboere mistet også hjernevolumet mer og raskere enn kroppsstørrelsen.

Men! Det er det som er viktig, i mange år eksisterte konseptet ”hjerne rubicon”, man trodde at all “menneskelig” aktivitet bare er mulig når et visst volum av hjernen oppnås. 700, 900 gram, meningene var forskjellige. Noe som at Australopithecus hadde mindre - de var dumme, kunne ikke gjøre noe, men den tidlige Homo Rubicon krysset og hastet - fremstilling av verktøy, forsøk på å kommunisere og så videre. Og de tok små homoflorescenser, og de knakk ham på et smart hode. Alle forskere på en gang. Etter å ha mistet halvparten av hjernen, fortsatte de å lage enkle verktøy, skjerpet pinner, jaktet dvergelefanter (stegodons), med andre ord klarte på en måte å bevare kulturen de ankom øya med. Enten å miste buksene, vi holdt det viktigste, eller vi undervurderer viktigheten av trening og kunnskapsoverføring, men på en eller annen måte klarte vi å.

Vel, hobbyene, som mange andre, sier til oss: "Ikke tro at du vet alt, se og studer så lenge du kan".

På dette, kanskje, vil jeg stoppe handlekurven. Vel, hvis du ikke er sliten, vil jeg skritte noe annet.

Nyheter # 998: Mantis-kreps fant veien hjem gjennom stiintegrering

Hvordan sprekker virus cellene våre? Forklaring på 10 bilder

Et ekte virus, som et datavirus, er ikke annet enn programkode. Hvorfor aksepterer cellene våre pliktoppfyllende et utenlandsk program? Les bildetekster for å finne ut.

1. Enhver levende celle er en proteinfabrikk. Nesten alle cellestrukturer består av proteiner. Og proteinene i seg selv, som Lego murstein, er bygget av aminosyrer - små og enkle molekyler. Bare 20 aminosyrer er involvert i menneskekroppen.

2. På cellefabrikken jobber roboter - enzymer. Dette er også proteiner, men komplekse. De kan kombinere og bryte ned forskjellige molekyler, kontrollere kjemiske reaksjoner. I menneskeceller, omtrent 1300 typer enzymer. For eksempel bryter laktase melkeproteinlaktose til galaktose og glukose..

3. Enzymer er bygd her, i en cellefabrikk, sammen med andre proteiner. For å gjøre dette, inneholder cellen et sett med arbeidsdokumentasjon - DNA. Alle gener for konstruksjon av alle kroppsproteiner er registrert her. Lengden på DNA-molekylene til hver celle er nesten 2 m. De er kompakt vridd og pakket i 46 kromosomer..

4. DNA er en Talmud som beskriver strukturen til hele organismen. RNA-polymerase-enzymet beveger seg langs DNAet og kopierer individuelle ark av denne Talmud til RNA-molekyler. Et blad, et gen, består av kodoner som angir visse aminosyrer. Åpnings- og lukkekodonene forteller enzymet når de skal kutte det ferdige arket og begynne å skrive ut et nytt. Hvert RNA er en tegning av ett protein eller enzym..

5. Ribosomer er "maskiner" som enzymer produseres på. Så snart RNA med instruksjonen nærmer seg ribosomet, forbinder det aminosyrene i ønsket sekvens. Selve den resulterende kjeden kollapser i en romlig struktur - og et nytt enzym oppnås.

6. Aminosyrer, enzymer, RNA - de flyter alle sammen i den flytende cytoplasma av cellen, og beveger seg fritt og interagerer med hverandre. Virus bruker denne friheten.

7. Et typisk virus er et stykke DNA eller RNA i en proteinkasse. Han er ikke engang i live - det trenger han ikke. Dette er bare et program, en kode for utenlandske enzymer. Etter å ha nådd vertscellen, lanserer denne parasitten sin egen RNA.

8. Etter å ha møtt viralt RNA, produserer ribosomet pliktoppfyllende virusdetaljer: nye konvolutter og kopier av RNA. Cellulære enzymer er med på å samle mange eksemplarer av viruset. Klargjorte virus forlater cellen.

9. Det er forskjellige varianter av virus. For eksempel kan retrovirus integrere instruksjonene deres direkte i vertscellens DNA. Menneskelig DNA inneholder en enorm mengde søppelgener som har samlet seg etter møter med slike midler. Coronavirus tar en del av vertscellemembranen med seg som en ekstra membran.

Det interaktive skjemaet for viruset, se her: in2minutes.ru

Nyheter # 994: Jazzgitarister gjør improvisasjon uten kognitiv kontroll

En sammensatt befolkningshistorie og urenhetsmønstre i menneskeslekten. Neanderthals, Denisovans, erectuses, etc.

Urenheten er dominerende i dannelsen av modeller for genetisk variasjon. En sammenligning av sekvensene av genomene til gamle og moderne mennesker har registrert mange tilfeller av kors, inkludert strømmen av gener fra neandertaler og Denisovans, så vel som fra tidlige moderne mennesker til neandertaler. De relativt sjeldne funnene og vanskene med å skaffe eldgamalt DNA gjør det imidlertid vanskelig å analysere antallet av eldgamle befolkningers bidrag til det genetiske mangfoldet til mennesker. Men her kommer nye metoder til unnsetning, som lar oss bestemme gamle urenheter, og hvert år blir disse metodene mer nøyaktige.

Denne artikkelen har samlet noen av de nyeste dataene fra årets arbeid. Vi vil snakke om anatomisk moderne mennesker fra den relativt nyere fortiden fra Vest-Afrika, og om neandertalere, Denisovans og deres forfedre med et underlig navn - neanderthanere, som igjen blandet seg med en eldre befolkning, sannsynligvis erectus, som bosatte Eurasia 1,9 millioner år tilbake.

Jeg begynner med en mindre fjern fortid.

Jeg må si med en gang at mange mennesker ofte gjør den samme feilen, og misforstå klimaet i det siste og Afrika er intet unntak. Som et eksempel er nye data innhentet gjennom analyse av fauna fra 10.200 til 4.650 år gammel fra Takarkori-hulen i Sahara-ørkenen i Libya. Hvor restene av fisk, som ciklider og steinbit, ble funnet, samt dyr som ble spist av innbyggerne i hulen.

Derfor, som representerer regionene i Afrika, er det verdt å ta høyde for forskjellen i klima i forskjellige perioder, fordi noen regioner en gang var fuktige og rike på både vann og liv, noe som fremgår av funnene i mange menneskelige bosetninger og mangfoldet av fauna.

Gamle vestafrikanske jegere og samlere i sammenheng med historien til den afrikanske befolkningen

I en artikkel som ble publisert i februar i år, siterer forfatterne DNA fra hele genomet til fire barn i alderen 8000 til 3000 år gamle fra Shum Lak-hulen i Kamerun, et av de tidligste kjente arkeologiske stedene i det sannsynlige hjemlandet til Bantu-språkgruppen - familien Benue-Kongoles. Selv om totalt 18 personer ble analysert, ble DNA fra bare 3 gutter fra 4 til 15 år og en jente på 4 år funnet å være egnet for videre analyser. I alle fall er dette de første genomene fra dette territoriet..

Eldre barn hadde haplogruppen mtDNA L0a2a1, som er ganske vanlig i Afrika og haplogruppene til Y-kromosomet B og A00. Haplogroup B er vanlig blant moderne jegere og samlere i Sentral-Afrika, og A00 er den eldste linjen som dukket opp fra 200 til 300 tusen år siden.

Analysen viste at moderne jegere og samlere ikke er etterkommere av befolkningen hvis representanter er gravlagt i Shum Lak-hulen, som de fleste moderne Bantu-høyttalere. Representanter for Noise Luck er genetisk nærmere talerne for Grassfield-gruppen av bantoide språk. Og de bodde i regionen i minst 5 tusen år, hvoretter de ble erstattet av heterogene grupper mennesker hvis etterkommere for tiden bor i disse områdene.

3 hovedforgreningssentre for populasjoner ble identifisert med 4 separate linjer, som er lettere å oppfatte på grafen. Det skal bemerkes at nodepunktene ikke betyr samtidig divergens og sekvens, men bare skjematisk indikerer et relativt lite tidsintervall.

Viktige punkter er:

1. Den tidlige inndelingen av mennesker i befolkninger assosiert med sentralafrikanske jeger-samlere for omtrent 300-200 tusen år siden (svart), i sørafrikanske jeger-samlere for omtrent 250-200 tusen år siden (rød), i andre populasjoner av moderne mennesker (oransje farge), og til en ukjent populasjon som det ikke er data for (blå) for. Linjen knyttet til de sentralafrikanske jeger-samlerne er på sin side delt inn i østlige og vestlige, og sistnevnte fører til representantene for Shum Lak.

2. Denne noden deler seg inn i den basale vestafrikanske linjen (grønn farge), i befolkningen av mennesker som deretter gikk utover Afrika (gul), i østafrikanske husdyrbønder (syrin), og i befolkningen som er tilknyttet innbygger i den etiopiske hulen Mota, alder 4500 år. Isolasjon av en befolkning assosiert med alle ikke-afrikanere skjedde for mellom 80 og 70 tusen år siden. Dette stemmer overens med mtDNA-fylogeografi, spesielt med isolasjonen av haplogruppe L3, som antagelig har sin opprinnelse i Øst-Afrika for rundt 70 000 år siden. Det er også i samsvar med isolasjonen av haplogruppen til CT Y-kromosomet i samme periode. Disse mutasjonene er til stede i alle moderne mannlige menneskelige linjer, med unntak av A og B-M60.

3. Nettstedet er assosiert med utvidelsen av stamtavlen assosiert med morsmål i Bantu.

I det hele tatt bekrefter resultatene de nyere argumentene fra genetikere og arkeologer om at opprinnelsen til mennesket i Afrika kan omfatte dypt divergerende, geografisk atskilte bestander. Men det er også verdt å merke seg tilstedeværelsen i området av avviket med neandertalerne, en annen ukjent stamfar med mennesker.

Identifisering og tolkning av en eksplisitt neandertaler-stamtavle blant afrikanere

Essensen i denne studien er å beskrive en ny teknikk som lar deg oppdage gamle urenheter i genomene til moderne mennesker. Det mest interessante var oppdagelsen av et 0,3% neandertalgenom hos afrikanere.

Selv om det tidligere ble antatt at bare ikke-afrikanske befolkninger hadde en blanding av neandertalere, var omtrent 2%. Det er bemerkelsesverdig at noen av de oppdagede haplotypene er assosiert med en reaksjon på ultrafiolett lys. Men afrikanere kunne ikke møte neandertalere. Dessuten er 94% av neandertaler-urenheter hos afrikanere til stede i mennesker utenfor Afrika. Resultatene fra tilleggsstudier viste at det var en omvendt migrasjon til Afrika, mennesker som allerede er med neandertaler. Men også i mindre grad var det en blanding fra sapiens til neandertaler før moderne mennesker forlot Afrika. Den nye metoden viste også at spor av neandertalere i asiatiske befolkninger er mer enn 8% mer enn i europeiske, selv om det tidligere ble antatt at denne forskjellen er 20%.

Generelt sett er metoden ganske interessant, men den fungerer bare i tilfelle du søker etter det genetiske bidraget fra kjente eldgamle populasjoner, hvis genom allerede er blitt sekvensert.

Men i det neste verket, publisert mindre enn 2 uker senere, etter det ovennevnte, ble en metode allerede brukt for å bestemme hvordan det er mulig å identifisere DNA-segmenter av gammel opprinnelse uten tilstedeværelse av en sekvensert prøve av genomet til deres bærere..

Signal restaurering av en ukjent gammel urenhet i afrikanske befolkninger

I dette arbeidet ga forskere flere bevislinjer for arkaiske urenheter i fire vestafrikanske befolkninger. Disse befolkningene er representert av Ishan-folket fra det sørlige Nigeria, det gambiske folket, Mende-folket i Sierra Leone og en gruppe relaterte Yoruba-folk fra Nigeria. Analysen viste at disse populasjonene fikk fra 2 til 19% av deres genetiske opprinnelse fra den eldgamle befolkningen, som kommer fra en felles linje til separasjonen av neandertalere og moderne mennesker..

Og dette bidraget ble også funnet i europeiske befolkninger, som bekrefter urenhetens tid før frigjøring av anatomisk moderne mennesker fra Afrika. Ved å bruke en metode som kan identifisere segmenter av gammel opprinnelse uten å måtte referere til sekvenserte gamle genom, konstruerte forfatterne kart over den genomiske opprinnelsen til de tidligere listede populasjonene. Analysen deres avdekket segmenter med ukjent gammel opprinnelse med høy frekvens.

Resultatene viser et betydelig bidrag av gammel opprinnelse til dannelsen av genbassenget til moderne vestafrikanske bestander. Men på grafen var en urenhet fra den eldgamle befolkningen før folk forlot Afrika.

En nylig tolkning av urenheten som forskere har dokumentert, er at arkaiske former vedvarte i Afrika til relativt nylig. På den annen side kunne en eldgammel befolkning tidligere gi et genetisk bidrag til den moderne menneskelige befolkningen, som deretter ble krysset med forfedrene til populasjonene som ble analysert i denne studien. Selv om disse modellene ikke er gjensidig utelukkende, er det sannsynlig at afrikaners historie inkluderer genetiske bidrag fra mange forskjellige populasjoner, noe som fremgår av den store effektive befolkningsstørrelsen, som er genetisk relatert til det arkaiske. Mens anatomisk moderne mennesker vises i fossilprotokollen for rundt 200 tusen år siden, ble relativt unge fossiler med en kombinasjon av arkaiske og moderne anatomiske trekk funnet i Afrika sør for Sahara og Midt-Østen.

Eksempler på slike fossiler er en hodeskalle fra Ivo Eleru, i sørvest i Nigeria, 13 tusen år gammel og menneskelige rester fra Ishango i den moderne demokratiske republikken Kongo, subsidiert i omtrent 20 tusen år, som ikke passer inn i variasjonen til det moderne mennesket. Og dette kan indikere at relativt nylig mennesker som var forskjellige fra moderne, vandret rundt i Afrika og bidro til det genomiske mangfoldet av afrikanere, og demonstrerte den komplekse historien til interaksjonen mellom moderne og arkaiske mennesker i Afrika. Ikke-afrikanske populasjoner har også lignende blandinger, noe som antyder at en del av arkaisk opprinnelse var til stede før separasjonen av de afrikanske og ikke-afrikanske populasjonene. En detaljert forståelse av arkaiske genetiske urenheter og deres rolle i tilpasning til forskjellige miljøforhold vil kreve en analyse av moderne og gamle genom gjennom hele det geografiske området i Afrika..

Forfedre til neandertalere og Denisovans krysset med fjerne slektninger til mennesker

Forfatterne av dette verket "gravde" enda dypere enn de forrige, for hundretusenvis av år siden, da representanter for slekten til mennesker med en større hjerne dukker opp i fossilene i Europa sammen med Acheulean steinredskaper. Det er uenighet om hvordan disse første europeerne skal tolkes. Noen ser dem som de vanlige forfedrene til moderne mennesker og neandertaler, andre som en evolusjonsforvirring, som senere ble erstattet av innvandrere fra Afrika, og atter andre som de første representantene for neandertalens avstamning. Nye estimater er mest konsistente med det siste av disse synspunktene. De antyder at for 600 tusen år siden var neandertalerne allerede en egen linje, atskilt ikke bare fra linjen til moderne mennesker, men også fra Denisovans. Disse resultatene løser motsetningene med fossilene til Heidelberg-mannen fra Sima de los Huesos, som opprinnelig ble datert for minst 350 tusen år siden. Genetiske data viste at de var representanter for en tidligere bestand av forfedre før neandertalerne og derfor etter atskillelsen av neandertalerne og Denisovans. Imidlertid indikerte genetiske data at denne splittelsen skjedde for rundt 381 tusen år siden. Dette var vanskelig å forene med den estimerte alderen på fossilene fra Sima de los Huesos, men avviket økte senere, fordi forbedrede dateringsmetoder viste fossilenes alder, omtrent 600 tusen år og mye eldre enn den molekylære datoen for separasjon av Denisovanerne og neandertalerne. Dette avviket skyldes delvis forskjellige kalibreringer av hastigheten på mutasjoner. Forskere ved Institutt for antropologi, University of Utah, bemerker også at de nye neandertalertallene er forskjellige fra det de publiserte i 2017 og som ble kritisert av kollegene. For øvrig er dette et godt eksempel på at forskere erkjenner feilene sine. I følge nye estimater fra forfatterne av studien, blir denne konflikten løst ved å overføre separasjonsdatoen langt utover fossilens alder fra Sima de los Huesos, ved å bruke genom med høyere genom fra neandertalhulen i Vindia i det moderne Kroatia, så vel som Altai Denisovan og neandertalmannen. På samme tid var neandertaler som delte sitt DNA med moderne europeere, genetisk mer som en neandertaler fra hulen i Vindia enn en neandertaler fra Denisova-hulen. Det er verdt å merke seg at forskjellige neandertalere bodde i Altai. Relativt nær Denisova-hulen ligger Chagyrska-hulen, hvor neandertalere fra den andre bosettingsbølgen bodde, som skilte seg fra sine eldgamle naboer, både i steinindustrien og genetisk.

Den nye rekonstruksjonen inkluderer tre bølger av folkevandringen fra Afrika til Eurasia:

1. Migrasjon av den tidlige Homo eller “super eldgamle” befolkningen for rundt 1,9 millioner år siden. Hva sammenfaller med dateringen av Dmanis hominider.

2. Migrasjon for rundt 700 tusen år siden av fedrelinjen til neandertalere og Denisovans før deres separasjon. For enkelhets skyld kalte forskerne denne befolkningen, og kombinerte to ord - neandertalere og Denisovans. For oss er det noe som "Neanders".

3. Migrasjonen av moderne mennesker for rundt 50 tusen år siden.

Samtidig viser resultatene at neanderderne krysset med representanter for den super eldgamle befolkningen i begynnelsen av Midt-Pleistocen, kort tid etter deres ankomst til Eurasia. Mest sannsynlig var de eurasiske ereksjoner. Dette er den tidligste kjente blandingen mellom bestander av slekten mennesker. I tillegg var disse to populasjonene mer fjernt beslektet med hverandre enn de andre populasjonene i den for tiden kjente som krysset hverandre. De ble inndelt etter opprinnelse i 1,2 millioner år. Senere, da representanter for den "super eldgamle" befolkningen av mennesker utvekslet gener med Denisovans, ble disse to populasjonene enda mer adskilt i tid. Til sammenligning var neandertalerne og Denisovans, som krysset med moderne mennesker, under 700 tusen år fra hverandre. Det er sannsynlig at de "super eldgamle" menneskene stammet fra den opprinnelige befolkningen i Eurasia, hvis estimerte antall var fra 20 til 50 tusen mennesker. En slik størrelse indikerer at denne populasjonen inkluderte minst to dypt delte undergrupper, hvorav den ene er blandet med Neanders og den andre med Denis. Forskere antyder at for 700 000 år siden forlot neandereanere Afrika til Eurasia, opplevde effekten av en flaskehals eller en reduksjon i genbassenget, krysset med eldgamle bestander av mennesker i Eurasia som har bodd der i mer enn en million år, og deretter erstattet dem i stor grad etter tur delt inn i østlige og vestlige underpopulasjoner - Denisovans og neandertaler. Lignende hendelser skjedde for 50 tusen år siden, da anatomisk moderne mennesker forlot Afrika og erstattet neandertalere og Denisovans..

Dette arbeidet er også bemerkelsesverdig i og med at det demonstrerer hvor mye tid som trengs, slik at isolerte bestander av mennesker fremdeles kan avle sammen. Det viser seg at minst 1,2 millioner år under de samme forhold.

Avslutningsvis vil jeg fokusere på det faktum at alle de nevnte verkene ble utgitt med en kort pause i år. Tenk deg derfor hvor mye informasjon som vises på forskjellige vitenskapsområder hver måned..